Skip to content

Modellazione dinamica e strumenti per la valutazione sperimentale del comportamento della via EGFR-IGF1R per la linea cellulare H1650

Gratis La preview di questa tesi è scaricabile gratuitamente in formato PDF.
Per scaricare il file PDF è necessario essere iscritto a Tesionline. L'iscrizione non comporta alcun costo: effettua il Login o Registrati.

Mostra/Nascondi contenuto.
2. La Systems Biology 16 GTGCATCTGACTCCTGAGGAGAAG CACGTAGACTGAGGACTCCTCTTC GUGCAUCUGACUCCUGAGGAGAAG V H L T P E E K DNA (transcription) RNA (translation) protein Figura 2.5: La sequenza di DNA di un gene codica la sequenza di amminoacidi di una proteina Molte malattie genetiche sono il risultato della mancanza o dell’inattivit a di enzimi o di altre proteine essenziali. Queste, a loro volta, sono provocate da mutazioni nei geni che codicano per le proteine. Quando gli alleli 3 prodotti da mutazioni sono recessivi, le malattie sono evidenti solo negli individui omozigoti. 2.2.3 Geni, virus e cancro [10] [13] Il cancro e una malattia in cui le cellule sfuggono alle norme, ancora in gran parte sconosciute, che regolano la normale crescita cellulare. Ne consegue che le cellule si moltiplicano senza un controllo, invadendo e distruggendo gli altri tessuti. Gi a da molto tempo tre serie di fatti accertati hanno messo in rapporto lo sviluppo del cancro con certe variazioni che si vericano nel materiale genetico: 1. una volta che una cellula e diventata cancerogena, tutte le cellule glie sono cancerogene, in altre parole, il cancro e una propriet a ereditaria della cellula; 2. spesso nelle cellule cancerogene sono visibili grosse anomalie cromosomiche, come delezioni e traslocazioni; 3. la maggior parte degli agenti cancerogeni, quali i raggi X, la radiazione ultra- violetta, il fumo da tabacco e una certa variert a di prodotti chimici, sono anche mutageni. Fin dal 1911 un virus cancerogeno, il virus del sarcoma di Rous, e stato isolato da cellule tumorali dei polli. Sebbene, a pi u riprese, siano stati scoperti altri virus cance- rogeni, in particolare i virus che colpivano i topi di laboratorio, fece fatica ad emergere un’ipotesi virale del cancro. Da un lato, non si riusciva a dimostrare che i virus fossero in qualche modo implicati nell’insorgere del cancro nell’uomo (ancora oggi, dopo anni 3 In genetica si denisce allele o fattore ogni variante di sequenza di un gene o di un locus genico (generalmente un gruppo di geni).
Anteprima della tesi: Modellazione dinamica e strumenti per la
valutazione sperimentale del comportamento
della via EGFR-IGF1R per la linea cellulare
H1650, Pagina 10

Preview dalla tesi:

Modellazione dinamica e strumenti per la valutazione sperimentale del comportamento della via EGFR-IGF1R per la linea cellulare H1650


La consultazione è esclusivamente in formato digitale .PDF


Informazioni tesi

  Autore: Giulio Spinozzi
  Tipo: Laurea liv.II (specialistica)
  Anno: 2011-12
  Università: Università degli Studi di Perugia
  Facoltà: Ingegneria
  Corso: Ingegneria informatica
  Relatore: Paolo Valigi
  Lingua: Italiano
  Num. pagine: 132


Per consultare la tesi è necessario essere registrati e acquistare la consultazione integrale del file, al costo di 29,89€.
Il pagamento può essere effettuato tramite carta di credito/carta prepagata, PayPal, bonifico bancario, bollettino postale.
Confermato il pagamento si potrà consultare i file esclusivamente in formato .PDF accedendo alla propria Home Personale. Si potrà quindi procedere a salvare o stampare il file.
Maggiori informazioni
Ingiustamente snobbata durante le ricerche bibliografiche, una tesi di laurea si rivela decisamente utile:
  • perché affronta un singolo argomento in modo sintetico e specifico come altri testi non fanno;
  • perché è un lavoro originale che si basa su una ricerca bibliografica accurata;
  • perché, a differenza di altri materiali che puoi reperire online, una tesi di laurea è stata verificata da un docente universitario e dalla commissione in sede d'esame. La nostra redazione inoltre controlla prima della pubblicazione la completezza dei materiali e, dal 2009, anche l'originalità della tesi attraverso il software antiplagio
  • L'utilizzo della consultazione integrale della tesi da parte dell'Utente che ne acquista il diritto è da considerarsi esclusivamente privato.
  • Nel caso in cui l'Utente volesse pubblicare o citare una tesi presente nel database del sito deve ottenere autorizzazione scritta dall'Autore della tesi stessa, il quale è unico detentore dei diritti.
  • L'Utente è l'unico ed esclusivo responsabile del materiale di cui acquista il diritto alla consultazione. Si impegna a non divulgare a mezzo stampa, editoria in genere, televisione, radio, Internet e/o qualsiasi altro mezzo divulgativo esistente o che venisse inventato, il contenuto della tesi che consulta o stralci della medesima. Verrà perseguito legalmente nel caso di riproduzione totale e/o parziale su qualsiasi mezzo e/o su qualsiasi supporto, nel caso di divulgazione nonché nel caso di ricavo economico derivante dallo sfruttamento del diritto acquisito.
  • L'Utente è a conoscenza che l'importo da lui pagato per la consultazione integrale della tesi prescelta è ripartito, a partire dalla seconda consultazione assoluta nell'anno in corso, al 50% tra l'Autore/i della tesi e Tesionline Srl, la società titolare del sito
L'obiettivo di Tesionline è quello di rendere accessibile a una platea il più possibile vasta il patrimonio di cultura e conoscenza contenuto nelle tesi.
Per raggiungerlo, è fondamentale superare la barriera rappresentata dalla lingua. Ecco perché cerchiamo persone disponibili ad effettuare la traduzione delle tesi pubblicate nel nostro sito.

Scopri come funziona »

DUBBI? Contattaci

Contatta la redazione a
[email protected]

Ci trovi su Skype (redazione_tesi)
dalle 9:00 alle 13:00

Oppure vieni a trovarci su

Parole chiave

western blot
western blotting
systems biology
biologia dei sitemi

Non hai trovato quello che cercavi?

Abbiamo più di 45.000 Tesi di Laurea: cerca nel nostro database

Oppure consulta la sezione dedicata ad appunti universitari selezionati e pubblicati dalla nostra redazione

Ottimizza la tua ricerca:

  • individua con precisione le parole chiave specifiche della tua ricerca
  • elimina i termini non significativi (aggettivi, articoli, avverbi...)
  • se non hai risultati amplia la ricerca con termini via via più generici (ad esempio da "anziano oncologico" a "paziente oncologico")
  • utilizza la ricerca avanzata
  • utilizza gli operatori booleani (and, or, "")

Idee per la tesi?

Scopri le migliori tesi scelte da noi sugli argomenti recenti

Come si scrive una tesi di laurea?

A quale cattedra chiedere la tesi? Quale sarà il docente più disponibile? Quale l'argomento più interessante per me? ...e quale quello più interessante per il mondo del lavoro?

Scarica gratuitamente la nostra guida "Come si scrive una tesi di laurea" e iscriviti alla newsletter per ricevere consigli e materiale utile.

La tesi l'ho già scritta,
ora cosa ne faccio?

La tua tesi ti ha aiutato ad ottenere quel sudato titolo di studio, ma può darti molto di più: ti differenzia dai tuoi colleghi universitari, mostra i tuoi interessi ed è un lavoro di ricerca unico, che può essere utile anche ad altri.

Il nostro consiglio è di non sprecare tutto questo lavoro:

È ora di pubblicare la tesi